SALK lines
Donated by
- Joseph R. Ecker Plant Biology Laboratory, The Salk Institute for Biological Studies
Description
These stocks are single, segregating flank-tagged T3-generation T-DNA lines generated by vacuum infiltration of Columbia (Col) plants with Agrobacterium tumefaciens vector pROK2.
How to Order
We recommend you use Salk website to find you SALK knockout, you can also search germplasm database directly here. Please note that NASC and ABRC are using a different numbering system for the SALK lines. e.g.
- N500001 is the same line as SALK_000001.
- N513247 is the same line as SALK_013247.
- N600000 is the same line as SALK_100000.
Ordering Issues
There is a period of *SIX WEEKS* between the curation of sequence into the SALK database and release of the seeds to ABRC. Given that the seeds must arrive at ABRC and then be passed onto NASC, please allow a MINIMUM of 8 WEEKS from your order until you query NASC about the arrival of your seeds. If you are a European user and you try to order or re-order from TAIR this will tend to cause a delay while your order is reprocessed.
Background
Col-8 (Columbia) Columbia ecotype (N60000), background line used by J. Alonso, W. Crosby and J. Ecker to generate T-DNA stocks; shown to be genetically equivalent to the Redei Columbia and to TAMU and IGF BACs.
Kanamycin
Kanamycin is employed for selection of plants having T-DNA insertions. DNA sequencing was performed on plants for the same sample of seeds that are being distributed. Investigators should confirm the presence of the T-DNA insertion in the gene by PCR using primers from the T-DNA Left-border and the target gene sequence.
At the Seville Arabidopsis 2002 meeting, the donors of the SALK lines announced that due to apparent silencing of the kanamycin gene within the SALK population, 20% of lines are sensitive to kanamycin selection. If your line is kanamycin sensitive, this is not in any way suggestive that you have been given the wrong line. Please confirm the line by PCR of the kanamycin gene and/or the insert/target. Please also note that this is 20% OF LINES and NOT an issue of segregation.
It has also been found by Pellow et al. (1990) that reduced NPTII activity in pCIB10 and its derivatives may necessitate using a working concentration of 10-40 µg/ml Kanamycin for selection in plants, rather than the 100µg/ml suggested in other literature.
Sequencing of the insert
The T-DNA left border sequence was used for PCR amplification of plant flanking sequences.
For PCR 1, LBa1 primer:
- 5' tggttcacgtagtgggccatcg 3'
For PCR 2 and sequencing, LBb1 primer:
- 5' gcgtggaccgcttgctgcaact 3'
SALK Seq Lines
New insertions have been identified for a number of the segregating SALK, SAIL and WiscDsLox lines. These insertions have been identified by TDNA-Seq, a next-generation sequencing method for capturing T-DNA flanking sequence tags developed in the Ecker laboratory.
Some of these have been isolated and donated as new lines available to order with NASC. These are noted on the parent SALK's stock page and are searchable through our quick search using the keyword ' SALKseq* '.
Related links
References
- Alonso, J.M. et al. 2003. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301(5633):653-7.PubMed ID: 12893945.